Ecology and Resilient Infrastructure. September 2018. 163-173
https://doi.org/10.17820/eri.2018.5.3.163


ABSTRACT


MAIN

  • 1. 서 론

  • 2. 재료 및 방법

  •   2.1 바이오폴리머 혼합, Camelina 파종 및 가뭄 조건 처리

  •   2.2 바이오폴리머와 토양의 최적 혼합 비율 탐색

  •   2.3 바이오폴리머 처리에 따른 식물의 생리적 변화 측정

  •   2.4 기공전도도, 전해질 유출도 및 상대수분함량 측정

  •   2.5 토양 수분 함량 측정

  •   2.6 수분수송관련 유전자 RT-PCR

  • 3. 결과 및 고찰

  •   3.1 바이오폴리머 혼합 농도의 적정 기준 설정

  •   3.2 바이오폴리머 혼합 및 가뭄 처리에 따른 Camelina의 생리적 반응 분석

  •   3.3 바이오폴리머 혼합 및 가뭄 처리에 따른 Camelina의 근권 발달

  •   3.4 바이오폴리머 혼합 및 가뭄 처리에 따른 Camelina의 수분수송 관련 유전자의 발현 분석

  • 4. 결 론

1. 서 론

화석연료에 대한 의존도는 환경오염과 더불어 심각한 이상기후를 야기하며, 이로 인한 가뭄 및 홍수는 많은 경제적 손실을 발생시킨다. 기존 조사에 의하면 국내 홍수 피해의 약 30%가 제방과 관련 되어있으며, 가뭄으로 인한 제방 강도의 약화가 주요 원인으로 지적되었다 (Vahedifard et al. 2015). 식물의 근권은 토양 표면뿐만 아니라 깊은 곳까지 발달하여 토양 입자에 흡착되어 있음으로써 유실을 방지하는 역할을 한다 (Ghestem et al. 2011). 그러나 지구온난화로 인한 대표적 환경 스트레스인 가뭄은 식생 파괴의 주요 원인이며, 이로 인한 근권 활력 감소는 제방 강도를 약화시킨다. 제방 보강을 위한 재료로써 시멘트는 제방 사면 및 밑다짐공의 보강을 위한 경성 호안블럭 용으로 가장 널리 쓰이는 재료 중 하나이다. 그러나 이는 생산에서부터 시공 및 유지관리 전 과정에 거쳐 환경 친화적 재료가 될 수 없으며, 하천 제방과 같이 친환경적 여건이 강조되는 경우 그 사용을 최대한 자제하는 것이 바람직하다. 시멘트는 강도가 강하고 내구성이 좋은 장점이 있지만, 1톤 생산 당 222 kg의 이산화탄소가 배출되고 토양과 혼합 시 pH를 증가시키며 물과 접촉 시 지표수와 지하수를 부분적으로 오염시키는 등 환경 및 주변 식생에 다양한 문제를 야기하고 있다 (Worrell et al. 2001, Richman et al. 2006). 실제로 시멘트의 사용으로 인한 대기 중 이산화탄소량이 지속적으로 증가해왔으며 이를 줄이기 위한 다양한 노력에도 불구하고 2000년대 이후 급격한 증가 폭을 나타냈다 (Rapier 2012, Oss 2014). 뿐만 아니라 시멘트는 토양에 혼합되어 하이드록시 이온 (-OH)을 방출하기 때문에 토양 pH를 12 - 13까지 급격하게 증가시킨다 (Taylor 1997). 높아진 pH는 식물성 플랑크톤의 생장에 영향을 주며 (Hansen 2002), 특히 시멘트로 포장된 제방사면은 식생이 자랄 수 없어 하천의 수변서식처 형성에 치명적인 결점이 된다. 따라서 기존의 물질을 대체하고 지속 가능한 친환경 신소재의 필요성이 더욱 대두되고 있다.

바이오폴리머는 미생물이 생성하는 생합성 물질로 β-glucan, curdlan, xanthan gum이 대표적이다. β- glucan의 토양 혼합은 토양 입자 및 양성자와의 이온결합을 형성하여 토양의 강도를 강화하고 토양 수분보유력을 향상시키는 효과가 보고되었다 (Chang and Cho 2012). Xanthan gum 역시 토양 입자의 전하와 직접적인 상호작용 (e.g. 수소결합)을 통해 다른 입자 간 가교역할을 하여 토양의 강도를 강화하고 수분보유력을 증가시키며, 토양 유실 감소 효과가 있는 것으로 보고된 바 있다 (Chang et al. 2015). 본 연구에서는 β-glucan과 xanthan gum을 주 구성물질로 하는 새로운 바이오폴리머를 한국과학기술연구원 (KAIST)에서 제공받아, 바이오폴리머가 제방에 적용했을 때 주변 식생에 미치는 영향을 파악하고자 하였다.

본 연구에 사용 된 Camelina sativa L. (Camelina)는 십자화과에 속하는 식물로서 약 90일의 짧은 생육주기를 가지고, 높은 함량의 불포화지방산을 가진 종자를 생산하며, 다른 식물에 비해 척박한 환경에서도 비교적 잘 자라는 것으로 알려져 있다 (Yuan et al. 2008). 이 뿐만 아니라 저온 스트레스 (Kim et al. 2013), 염분 스트레스 (Matthees et al. 2018), 중금속 스트레스 (Park et al. 2014), 가뭄 스트레스 (Raza et al. 2015) 등 환경 스트레스 하에서 Camelina의 생산성 증대와 같은 다양한 연구가 보고되어 있으며, 바이오에너지 작물로 이용 되고 있다.

이를 바탕으로, 본 연구에서는 β-glucan 및 xanthan gum이 혼합된 새로운 바이오폴리머의 토양 처리가 가뭄 조건 하에서 Camelina의 생장에 미치는 영향을 알아보고자 생장과 발육 정도, 기공전도도, 전해질 유출, 상대수분 함량 등 생리적 반응을 측정하였고, 뿐만 아니라 식물의 분자 수준에서 일어나는 변화를 분석하기 위해 RT-PCR을 실시하여 수분수송관련 유전자인 aquaporin (PIP, TIP)의 발현 수준을 확인하였다. 궁극적으로 본 연구의 결과는 바이오폴리머가 혼합된 제방의 식생 연구에 대한 기초 자료로 사용 될 것이다.

2. 재료 및 방법

2.1 바이오폴리머 혼합, Camelina 파종 및 가뭄 조건 처리

본 연구는 KAIST에서 새롭게 개발한 바이오폴리머를 제공 받아 진행되었으며, 개발자에 의하면 바이오폴리머 powder 및 용액을 물과 1.6 L : 0.1 kg : 9 L의 비율로 혼합하고, 이를 30 kg의 일반 상토 ((주)팜한농)와 섞을 경우 0.5%의 바이오폴리머 토양 혼합물을 만들 수 있다. 이를 기준으로 하여, 실험 목적에 따라 바이오폴리머. 혼합물과 상토의 비율을 변화시켜 시험하였다. 바이오폴리머가 처리된 상토를 1포트당 300 g씩 분배하였으며, 각 포트당 10주의 Camelina를 파종하였다. 이후 24시간의 춘화처리를 거친 뒤, 발아의 시점을 동일시하기 위하여 각 포트의 표면에 30 mL의 수분을 균일하게 1회 공급하여 발아를 유도하였다.

가뭄 조건 하에서 식물에 대한 바이오폴리머의 영향을 조사하기 위해, 일반 조건은 1일 1회 저면관수를 통해 수분을 공급한 반면, 가뭄 조건은 종자 발아를 위한 최초 30 mL 급수 이외의 수분공급을 중단하여 생육 및 관찰하였다.

2.2 바이오폴리머와 토양의 최적 혼합 비율 탐색

본 실험에 앞서 토양과 혼합된 바이오폴리머의 최적 농도를 알아보기 위하여 다양한 농도처리에 따른 Camelina의 생육을 비교하였다. 각각 0, 0.25, 0.5, 1% 바이오폴리머 혼합 토양에 가뭄 조건을 발아 이후 25일 동안 처리하여 Camelina의 표현형을 관찰하고, 기공전도도 및 전해질유출도를 측정하였다.

2.3 바이오폴리머 처리에 따른 식물의 생리적 변화 측정

예비 실험 결과 0.5% 바이오폴리머. 혼합 토양이 가뭄 조건 하에서 바이오폴리머 유무에 따른 Camelina의 생리적 반응 분석에 적합한 것으로 판단되었다. 보다 다양한 생리적 반응을 분석하기 위하여 0.5% 바이오폴리머를 토양에 혼합 후, 발아부터 25일 동안 가뭄 처리 된 Camelina의 식물 전체 및 3차 본엽을 이용하여 신장, 엽장 및 엽폭을 측정하였다. 이후 재급수를 통해 식물의 회복 정도를 측정하였다.

가뭄 처리 시간 별 식물의 생육 반응을 비교하기 위하여 추가적인 실험을 진행하였다. 바이오폴리머 혼합 유무에 따라 25일간 생육 된 Camelina에 급수 중단을 통해 가뭄 처리를 7일 및 10일 동안 하고, 각각의 기공전도도, 전해질유출도, 상대수분함량 (RWC)을 측정하였다.

바이오폴리머 혼합 및 가뭄 처리에 따른 Camelina의 근권 발달을 시험하기 위해, 특수 제작된 아크릴판 (크기 15×2.5×15(cm), 내부공간 13×0.5×15(cm))에 바이오폴리머가 혼합된 상토 및 일반 상토를 채운 후 Camelina 식물 5주를 일정 간격으로 파종하였다. 근권이 광에 노출되지 않도록 알루미늄 호일을 이용하여 아크릴판 외부를 감싸주었고, 약 30° 기울어진 환경에서 생육시켰다. 20일차에 근권을 관찰하였으며, 발달한 측근의 개수를 측정하였다.

2.4 기공전도도, 전해질 유출도 및 상대수분함량 측정

모든 형질은 Camelina의 3차 본엽을 이용하여 측정되었다. 기공전도도는 SC-1 leaf porometer model (Decagon Device, USA)을 이용하여 측정하였고, 일반 조건하에서 생육시킨 Camelina의 기공전도도 측정값을 기준으로 가뭄 조건의 측정값을 상대적으로 나타내었다.

전해질 유출도 측정을 위해, Camelina의 3차 본엽 (0.1 g)을 3차 멸균수 30 mL와 함께 test tube에 넣은 후 26°C에서 100 rpm, 2시간 동안 교반하였다. Blank 값을 위해 사용한 3차 멸균수의 전기전도도 (EC1)을 측정하고, IQ170 electrical conductivity meter (IQ scientific instruments, USA)를 사용하여 용액의 전기전도도 (EC2)를 측정하였다. 이후, 측정한 샘플을 멸균 시켜 용액의 전기전도도 (EC3)를 측정하여 전해질유출도의 최대치를 얻을 수 있었다. 상대적인 전해질유출도 (REC)를 계산하는 식은 다음과 같다.

REC%=EC2-EC1EC3×100

상대수분함량 (RWC)은 fresh weight (FW), turgor weight (TW), dry weight (DW)의 측정으로 결정된다. FW는 떼어낸 식물체의 무게를 측정한 값, TW는 떼어낸 식물체를 30 mL의 3차 멸균수와 함께 test tube에 넣어 26°C에서 100 rpm, 4시간동안 교반한 후 무게를 측정한 값, DW는 65°C에서 48시간 동안 완전건조 시킨 후 무게를 측정한 값이다. RWC(%)를 구하는 식은 다음과 같다.

RWC%=FW-DWTW-DW×100

2.5 토양 수분 함량 측정

0.5% 바이오폴리머가 혼합된 토양과 일반 토양에 충분한 급수를 통해 수분을 포화시킨 후, 급수 중단을 통한 가뭄 조건 하에서 매일 무게를 측정하였다. 이후 측정에 사용된 토양을 65°C 조건에서 완전건조 시켰다. 토양 수분 함량 측정 식은 다음과 같다.

토양 수분 함량 (g) = FW-DWTW-DW

2.6 수분수송관련 유전자 RT-PCR

Genome database로부터 확인된 Camelina 수분수송관련 CsPIP1;4, CsPIP2;1, CsPIP2;6, CsTIP1;2, CsTIP2;1 유전자의 염기 서열을 이용하여 각 유전자의 RT-PCR용 primer를 제작하였다 (Table 1).

바이오폴리머 혼합 유무 하에서 25일 동안 생육시킨 후 7일 및 10일 동안 가뭄 처리한 Camelina의 잎을 이용하여 total RNA를 추출하였다. 이후 DNase (InvitrogenTM, DNase I)를 처리하여 정제된 pure RNA를 확보하였고, reverse transcriptase (Takara, Primescript 1st strand cDNA synthesis kit) 를 이용한 cDNA 합성 후 RT-PCR을 수행하였다 (Table 2).

Table 1. The list of RT-PCR primer set used in this study

GenePrimer (5’ - 3’)Tm (℃)
CsPIP1;4ForwardATGGAAGGCAAAGAAGAAGA54.3
ReverseTTAGCTCTTGCTCTTGAAAG54.3
CsPIP2;1ForwardATGGCGAAGGATGTGGAAGC60.5
ReverseTTAGACGTTGGCAGCACTTC58.4
CsPIP2;6ForwardATGACCAAGGATGAGGAGTC58.4
ReverseTCAAGCGTGAAGCTCGTGAA58.4
CsTIP1;2ForwardATGCCGACCAGAAACATAGC58.4
ReverseTGGCAAAGCTAAGGAGGAAA56.4
CsTIP2;1ForwardGCCTTTGGTTCTTTTGGTGA56.4
ReverseCCGGTGATGACTGTGATTTG58.4

Table 2. RT-PCR conditions for each genes

GeneCondition
CsPIPs95℃, 5 min; 26 cycle (95℃, 30 s / 54℃, 1 min / 72℃ 30 s); 72℃, 5 min
CsTIPs95℃, 5 min; 27 cycle (95℃, 30 s / 56℃, 30 s / 72℃, 30 s), 72℃, 5 min

3. 결과 및 고찰

3.1 바이오폴리머 혼합 농도의 적정 기준 설정

본 실험에 앞서 토양과 혼합된 바이오폴리머의 최적 농도를 알아보기 위하여 다양한 농도처리에 따른 Camelina의 생육을 비교하였다. 각각 0, 0.25, 0.5, 1% 바이오폴리머 혼합 토양에 가뭄 조건을 25일 동안 처리하여 Camelina의 표현형을 관찰한 결과, 혼합 농도가 높을수록 가뭄으로 인한 피해가 감소하는 것을 확인하였다 (Fig. 1 (a)). 생리적 측면에서 식물에 대한 영향을 확인하기 위해 기공전도도 및 전해질유출도를 측정하였다. 보고된 바에 따르면 식물은 가뭄으로 인한 피해가 클수록 기공전도도는 감소하고, 전해질유출도는 증가하였는데 (Bagii et al. 2001, Masoumi et al. 2010, Ouyang et al. 2017), 측정 결과 또한 바이오폴리머의 농도가 높을수록 기공전도도는 증가하였으며, 전해질유출도는 감소하는 것을 확인하였다 (Fig. 1 (b) and 1 (c)). 이러한 결과를 통해 0.5% 바이오폴리머 혼합이 가뭄 조건 하에서 식물의 생장 차이를 관찰하기에 충분한 수준으로 판단되었고, 이후 수행된 실험에 적용하였다.

http://static.apub.kr/journalsite/sites/kseie/2018-005-03/N0190050307/images/kseie_05_03_07_F1.jpg
Fig. 1.

Comparison of physiological responses of Camelina with various BP concentrations under drought conditions. Plants were grown for 25 days without water supply (a). Stomatal conductance (b) and electrolyte leakage (c) were measured as physiological indicators.

3.2 바이오폴리머 혼합 및 가뭄 처리에 따른 Camelina의 생리적 반응 분석

0.5% 바이오폴리머를 토양에 혼합 후 발아부터 25일 동안 가뭄 처리 된 Camelina의 경우 바이오폴리머 혼합 유무에 따른 표현형이 확인되었다 (Fig. 2, 3 (a) and 3 (b)). 식물 전체 및 3차 본엽을 이용하여 신장, 엽장 및 엽폭을 측정한 결과, 가뭄 처리 되지 않은 식물은 신장, 엽장 및 엽폭 모두 큰 차이를 보이지 않았으나, 가뭄 처리 되었을 경우에는 바이오폴리머가 혼합된 식물의 신장, 엽장, 엽폭이 각각 25, 70, 170% 증가하였다 (Fig. 3 (c) - 3 (e)). 이후 재급수를 통해 회복시켜본 결과, 바이오폴리머 혼합구 식물의 회복률이 약 80% 높게 나타나는 것을 확인하였다 (Fig. 4). 이러한 결과는 수분이 충분한 조건 하에서는 바이오폴리머 혼합이 식물 생장에 영향을 미치지 않으나, 가뭄 조건 하에서는 긍정적인 영향을 미치는 것으로 보인다.

http://static.apub.kr/journalsite/sites/kseie/2018-005-03/N0190050307/images/kseie_05_03_07_F2.jpg
Fig. 2.

Comparison of phenotypes according to BP treatment in the soil and drought period at 5, 10, 15, 20, 25 days from germination.BP(-): control, BP(+): the soil amended with 0.5% BP

http://static.apub.kr/journalsite/sites/kseie/2018-005-03/N0190050307/images/kseie_05_03_07_F3.jpg
Fig. 3.

Comparison of growth patterns according to BP treatment in the soil and drought condition at 25 days. Plants were grown for 25 days without water supply and sampled as whole plant (a) and 3rd leaf (b), respectively. Plant height (c), leaf length (d) and width (e) were measured as physiological indicators. Bars and error bars indicate means and standard error of triplicate measurements. *** P < 0.001 (Duncan’s test)BP(-): control, BP(+): the soil amended with 0.5% BP

http://static.apub.kr/journalsite/sites/kseie/2018-005-03/N0190050307/images/kseie_05_03_07_F4.jpg
Fig. 4.

Comparison of recovery after BP treatment and drought condition. Plant were grown for 25 days under drought condition and recovered during 7 days (a) and quantification of the survived plants was measured after recovery (b). Bars and error bars indicate means and standard error of triplicate measurements. *** P < 0.001 (Duncan’s test)BP(-): control, BP(+): the soil amended with 0.5% BP.

이에 본 연구팀은 바이오폴리머 혼합 유무에 따른 식물의 생육에 미치는 영향을 정확하게 비교하기 위하여 추가적인 실험을 진행하였다. 바이오폴리머 혼합 유무에 따라 25일간 생육 된 Camelina에 급수 중단을 통해 가뭄 처리를 7일 및 10일 동안 하여 기공전도도, 전해질유출도, 상대수분함량 (RWC)을 측정한 결과, 7일 및 10일 동안의 가뭄 조건 하에서 대조구의 기공전도도는 바이오폴리머 혼합구에 비해 각각 약 50, 30% 낮게 측정되었다 (Fig. 5 (b)). 전해질 유출도의 경우, 바이오폴리머 혼합구가 7일 및 10일 동안의 가뭄 처리에서 대조구보다 각각 약 50, 70% 낮게 측정되었으며, 처리 기간이 길어질수록 대조구의 전해질 유출도가 큰 폭으로 증가하는 것을 확인하였다 (Fig. 5 (c)). 가뭄 처리에 따른 Camelina의 수분 보유량은 가뭄 7일차에서는 큰 차이가 나지 않았으나, 10일 차에 바이오폴리머 혼합구의 상대수분함량이 대조구에 비해 약 2배 높게 나타나는 것을 확인하였다 (Fig. 5 (d)).

http://static.apub.kr/journalsite/sites/kseie/2018-005-03/N0190050307/images/kseie_05_03_07_F5.jpg
Fig. 5.

Analysis of physiological responses according to BP treatment in the soil and drought condition. Plants were grown under normal condition for 25 days and treated drought for 7 (upper panel) or 10 days (lower panel), respectively (a). Stomatal conductance (b), electrolyte leakage (c), relative water content (d) were measured according to drought period (7 days-left panel, 10 days-right panel). Bars and error bars indicate means and standard error of triplicate measurements. ** P < 0.01, *** P < 0.001. BP(-): control, BP(+): the soil amended with 0.5% BP

이러한 생리적 반응에 대한 원인을 분석하기 위해 바이오폴리머 혼합에 따른 토양 수분 함량을 측정하였다. 가뭄 처리가 지속될수록 바이오폴리머 혼합 토양의 수분보유량이 대조구에 비해 소폭 감소하였으며, 10일 후 최대 15%의 수분보유력 차이를 확인하였다 (Fig. 6). 보고된 바에 따르면 β-glucan 및 xanthan gum 혼합 토양은 단자엽 식물인 귀리의 근권에서 토양입자와 물분자 간의 정전기적 결합을 통해 수분의 증발을 감소시키고, 발아 및 영양생장에 긍정적인 영향을 미친 바 있다 (Chang et al. 2015). 선행 연구와 본 연구의 결과로 보아, 토양에 혼합 바이오폴리머는 가뭄 조건 하에서 토양입자 및 물 분자와의 다양한 상호작용을 촉진시켜 토양 수분보유력을 향상시키며, 식물의 생육까지 향상시킬 수 있는 것으로 보인다.

http://static.apub.kr/journalsite/sites/kseie/2018-005-03/N0190050307/images/kseie_05_03_07_F6.jpg
Fig. 6.

Comparison of soil water content according to BP treatment in the soil and drought condition. BP(-): control, BP(+): the soil amended with 0.5% BP

3.3 바이오폴리머 혼합 및 가뭄 처리에 따른 Camelina의 근권 발달

바이오폴리머로 인한 토양 수분보유력의 차이가 식물의 근권 발달에 영향을 미칠 것으로 판단되어 근권 관찰이 가능한 아크릴판을 특수제작 하였고, 이를 이용하여 비교 실험을 진행하였다. 가뭄 조건 하에서 20일 동안 생육시킨 결과, 대조구에 비해 바이오폴리머 혼합구의 Camelina 뿌리의 발달이 억제된 것을 확인하였고, 바이오폴리머 혼합구의 측근 발달수가 대조구에 비해 약 40% 감소한 것을 확인하였다 (Fig. 7 (a) and 7 (b)). Park (1990)과 Coulpand and Johnson (1965)은 식물이 가뭄 조건에서 체내 수분포텐셜 유지를 위해 대조구 즉, 수분이 충분한 조건보다 7배 더 뿌리를 발달시킴으로써 깊은 토양의 수분을 흡수한다고 보고하였다. 본 연구의 결과도 바이오폴리머 혼합으로 토양의 수분함량이 상대적으로 높아짐에 따라 대조구에 비해 근권의 수분요구도가 낮아졌기 때문에 측근 형성 및 발달이 억제된 것으로 사료된다.

http://static.apub.kr/journalsite/sites/kseie/2018-005-03/N0190050307/images/kseie_05_03_07_F7.jpg
Fig. 7.

Comparison of lateral root development according to BP treatment in the soil and drought condition. Plants were grown 20 days under drought condition and observation (a) and quantification (b) of lateral root development were conducted. Bars and error bars indicate means and standard error of triplicate measurements. Statistical analysis was carried out using Duncan’s test. Asterisks indicate significant differences. *** P < 0.001 BP(-): control, BP(+): the soil amended with 0.5% BP

3.4 바이오폴리머 혼합 및 가뭄 처리에 따른 Camelina의 수분수송 관련 유전자의 발현 분석

가뭄 조건 하에서 바이오폴리머가 식물의 생장에 미치는 영향을 분자 수준에서 알아보기 위하여 Camelina의 수분 수송관련 aquaporin 중에서 CsPIP1;2, CsPIP2;1, CsPIP2;6 (원형질막 위치), CsTIP1;2, CsTIP2;1 (액포막 위치) 유전자의 발현 양상을 분석하였다. 25일 동안 생육 후 7일 혹은 10일 가뭄 처리 된 Camelina의 3차 본엽을 이용하여 total RNA를 추출 및 cDNA를 합성하였다. RT-PCR을 통해 발현 양상을 확인한 결과, CsPIP1;2, CsPIP2;1, CsPIP2;6, CsTIP1;2, CsTIP2;1 유전자 모두 가뭄 조건 하에서 바이오폴리머 혼합구에서 자란 Camelina 잎의 발현 수준이 대조구에 비해 상대적으로 높게 나타나는 것을 확인하였다 (Fig. 8). 가뭄과 유사한 삼투 스트레스를 처리했을 때 PIP (Plasma Intrinsic Protein) 유전자 발현 수준 및 단백질 수준이 감소하고, oocyte에 PIP 단백질을 발현 시켰을 때 수분 수송이 증가한다는 것이 Camelina와 Jatropha에서 밝혀진 바 있으며, Rice의 TIP (Tonoplast Intrinsic Protein) 역시 삼투 스트레스 하에서 유전자 발현 수준이 감소하는 것이 확인된 바 있다 (Li et al. 2008, Jang et al. 2013, 2014). 이러한 선행연구의 결과로 보아, 본 연구의 결과는 혼합된 바이오폴리머에 의해 증가된 토양 수분보유량에 따라 혼합구의 수분 수송이 활발하여 유전자 발현이 높게 나타났고, 반대로 대조구는 심각한 토양 수분손실로 인해 수분 수송 유전자의 발현이 억제되었을 것으로 추정된다. 추후 바이오폴리머 혼합 조건 하에서 증가된 토양 수분보유력으로 인해 나타나는 단백질 발현 수준의 변화 연구를 통해 보다 정확한 식물의 반응 메커니즘을 파악할 수 있을 것이다.

http://static.apub.kr/journalsite/sites/kseie/2018-005-03/N0190050307/images/kseie_05_03_07_F8.jpg
Fig. 8.

Expression of water-transport-related genes of Camelina according to BP treatment in the soil and drought condition. Plants were grown under normal condition for 25 days and treated drought for 7 (left panel) and 10 days (right panel). BP(-): control, BP(+): the soil amended with 0.5% BP

4. 결 론

본 연구에서 사용된 바이오폴리머는 미생물이 생성하는 β-glucan, xanthan gum, gellan gum 등을 원재료로 사용한다. 이들은 자연계에서 널리 존재하는 화합물들로 생태독성이 미미할 것으로 추정되며 (Chang et al. 2015), 제방 식생 형성 및 친환경성에 단점이 존재하는 시멘트와 비교했을 때 하천의 기본적인 흐름에 대한 침식저항 면에서 시멘트 호안블럭에 비견할 수 있으며, 특히 식생 이입 및 생장을 촉진하고 가뭄 시에도 잘 견딜 수 있어 제방 식생 조성에 긍정적으로 작용하게 된다. 실제로 제조된 바이오폴리머와 혼합된 토양은 귀리의 생육을 촉진시켰고 (Chang et al. 2014), 국내 하천에 자생하는 식물의 발아율이나 생장에 영향을 주지 않거나 혹은 촉진시키는 결과를 보였다 (J. An, unpublished data). 또한 원물질 중 하나인 gellan gum을 독성시험 모델 생물종인 Pseudokirchneriella subcapitata (조류)의 생육배지에 넣었을 때, 1000 mg/L의 농도에서 조류의 생장률은 대조군에 비해 0.65% 감소하는 결과를 보였다 (S. Kim, unpublished data). 이러한 결과로 볼 때, 바이오폴리머의 생태독성은 미미한 것으로 판단된다.

본 연구에서는 이와 같이 환경성이 검증된 바이오폴리머를 이용한 토양 혼합이 Camelina의 생육에 미치는 영향을 알아보고자 하였다. 특히 가뭄 조건 하에서 바이오폴리머의 혼합은 Camelina의 신장, 엽장 및 엽폭 등 식물의 생장에 긍정적인 영향을 미치고, 이는 기공전도도, 전해질유출, 상대수분함량 등 생리적인 지표로 확인되었으며 결과적으로 가뭄 조건 하에서 생육이 증진되었다. 그 원인으로는 바이오폴리머 물질이 토양 내에서 응집체로 작용하여 수분보유력을 증가시키며, 이로 인한 근권과 지상부의 보상적 상관 및 수분수송과 관련된 유전자들의 발현에 영향을 미쳤기 때문으로 판단된다.

이러한 결과를 종합해봤을 때, 친환경 신소재 바이오폴리머를 이용한 제방 토양으로의 혼합은 환경 스트레스 중 하나인 가뭄 조건 하에서 제방의 강도 강화와 더불어 수분보유력을 향상시켜 주변 식생의 피해를 감소시키는 긍정적인 효과를 기대할 수 있다. 하지만 다양한 환경 스트레스 중 단지 한 종류인 가뭄과 단 한가지 식물 종에 대한 실험 결과만으로 실제 제방에서 바이오폴리머가 식생에 미치는 영향을 뒷받침하기엔 부족하며, 높은 강도 증진 효과를 가지는 시멘트의 장점을 간과할 수도 없다. 따라서 시멘트 및 바이오폴리머가 식물의 생장 및 토양 등 환경적 지표에 미치는 영향에 대한 추가적인 비교분석을 통해 바이오폴리머의 긍정적 효과의 근거를 확보할 필요가 있으며, 가뭄 이외의 다양한 스트레스 하에서 바이오폴리머가 식물에 미치는 영향에 대한 연구가 추가적으로 수행되어야 하고, 나아가 실제 제방에 바이오폴리머를 처리하는 방법과 유사한 조건에서의 실험 및 제방에 자생하는 식물 종을 이용한 실험이 수행될 필요가 있다.

Acknowledgements

본 연구는 국토교통부 물관리연구사업의 연구비지원 (18AWMP-B114119-03)에 의해 수행되었습니다.

References

1 

Agassi, M. and Ben-Hur, M. 1992. Stabilizing steep slopes with soil conditioners and plants. Soil Technology 5: 249-256.

10.1016/0933-3630(92)90025-V
2 

Bajji, M., Kinet, J.M., and Lutts, S. 2001. The use of the electrolyte leakage method for assessing cell membrane stability as a water stress tolerance test in durum wheat. Plant Growth Regulation 36: 61-70.

10.1023/A:1014732714549
3 

Ben-Hur, M. and Letey, J. 1989. Effect of polysaccharides, clay dispersion, and impact energy on water infiltration. Soil Science Society of America Journal 53: 233-238.

10.2136/sssaj1989.03615995005300010041x
4 

Chang, I and Cho, G.C. 2012. Strengthening of Korean residual soil with β-1,3/1,6-glucan biopolymer. Construction and Building Materials 30: 30-35.

10.1016/j.conbuildmat.2011.11.030
5 

Chang, I., Im, J., Prasidhi, A.K., and Cho, G.C. 2015. Effects of Xanthan gum biopolymer on soil strengthening. Construction and Building Materials 74: 65-72.

10.1016/j.conbuildmat.2014.10.026
6 

Chang, I., Prasidhi, A.K., Im, J., Shin, H.D., and Cho, G.C. 2015. Soil treatment using microbial biopolymers for anti-desertification purposes. Geoderma 253-254: 39-47.

10.1016/j.geoderma.2015.04.006
7 

Coupland and Johnson. 1965. Rooting characteristics of native grassland species in Saskatchewan. Journal of Ecology 52: 475-507.

8 

Ghestem, M., Sidle, R.C., and Stokes, A. 2011. The influence of plant root systems on subsurface flow: Implications for slope stability. BioScience 61(11): 869-879.

10.1525/bio.2011.61.11.6
9 

Hansen, P.J. 2002. Effect of high pH on the growth and survival of marine phytoplankton: Implications for species succession. Aquatic Microbial Ecology 28: 279-288.

10.3354/ame028279
10 

Jang, H.Y., Rhee, J., Carlson, J.E., and Ahn, S.J. 2014. The Camelina aquaporin CsPIP2;1 is regulated by phosphorylation at Ser273, but not at Ser277, of the C-terminus and is involved in salt- and drought-stress responses. Journal of Plant Physiology 171: 1401-1412.

10.1016/j.jplph.2014.06.00925046761
11 

Jang, H.Y., Yang, S.W., Carlson, J.E., Ku, Y.G., and Ahn, S.J. 2013. Two aquaporins of Jatropha are regulated differentially during drought stress and subsequent recovery. Journal of Plant Physiology 170: 1028-1038.

10.1016/j.jplph.2013.03.00123537705
12 

Kim, H.S., Oh, J.M., Luan, S., Carlson, J.E., and Ahn, S.J. 2013. Cold stress causes rapid but differential changes in properties of plasma membrane H+-ATPase of camelina and rapeseed. Journal of plant physiology 170: 828-837.

10.1016/j.jplph.2013.01.00723399403
13 

Li, G.W., Peng, Y.H., Yu, X., Zhang, M.H., Cai, W.M., Sun, W.N., and Su, W.A. 2008. Transport functions and expression analysis of vacuolar membrane aquaporins in response to various stresses in rice. Journal of Plant Physiology 165: 1879-1888.

10.1016/j.jplph.2008.05.00218707797
14 

Masoumi, A., Kafi, M., Khazaei, H., and Davari, K. 2010. Effect of drought stress on water status, electrolyte leakage and enzymatic antioxidants of kochia (Kochia scoparia) under saline condition. Pakistan Journal of Botany 42: 3517-3524.

15 

Matthees, H.L., Thom, M.D., Gesch, R.W., and Forcella, F. 2018. Salinity tolerance of germinating alternative oilseeds. Industrial Crops and Products 113: 358-367.

10.1016/j.indcrop.2018.01.042
16 

Oss, H.G.V. 2014. Cement statistics and Information. US Geological Survey: Reston, VA, USA.

17 

Ouyang, W., Struik, P.C., Yin, X., and Yang, J. 2017. Stomatal conductance, mesophyll conductance, and transpiration efficiency in relation to leaf anatomy in rice and wheat genotypes under drought. Journal of Experimental Botany 68: 5191-5205.

10.1093/jxb/erx31428992130PMC5853379
18 

Park, W., Feng, Y., and Ahn, S.J. 2014. Alteration of leaf shape, improved metal tolerance, and productivity of seed by overexpression of CsHMA3 in Camelina sativa. Biotechnology for Biofuels 7: 96.

10.1186/1754-6834-7-9625018780PMC4094532
19 

Park, Y.M. 1990. Effects of drought on two grass species with different distribution around coastal sand-dunes. Functional Ecology 4: 735-741.

10.2307/2389440
20 

Rapier, R. 2012. Global Carbon Dioxide Emissions - Facts and Figures. Consumer Energy Report, USA.

21 

Raza, M.A.S., Shahid, A.M., Ijaz, M., Khan, I.H., Saleem, M.F., and Ahmad, S. 2015. Studies on canola (Brassica napus L.) and camelina (Camelina sativa L.) under different irrigation levels. ARPN Journal of Agricultural and Biological Science 10: 130-138.

22 

Richman, D.L., Tucker, C.L., and Koehler, P.G. 2006. Influence of Portland cement amendment on soil pH and residual soil termiticide performance, Pest Management Science 62: 1216-1223.

10.1002/ps.1274
23 

Taylor, H.F.W. 1997. Cement Chemistry; Thomas Telford Publishing, London, UK (in UK).

24 

Vahedifard, F., AghaKouchak, A., and Robinson, J.D. 2015. Drought threatens California’s Levees. Science 349: 799.

10.1126/science.349.6250.799-a26293945
25 

Worrell, E., Price, L., Martin, N., Hendriks, C., and Meida, L.O. 2001. Carbon dioxide emissions from the global cement industry. Annual Review of Environment and Resources 26: 303-329.

26 

Yuan, J.S., Tiller, K.H., Al-Ahmad, H., Stewart, N.R., and Stewart Jr, C.N. 2008. Plants to power: bioenergy to fuel the future. Trends in Plant Science 13: 421-429.

10.1016/j.tplants.2008.06.00118632303
페이지 상단으로 이동하기